JOM 2000-2297 Journal of Oral Microbiology, Vol. 1, November 2009, pp. 1–8 sici xxx PUBMED Abbreviation SheilaWalters MyriamBélanger PauloH.Rodrigues JoanWhitlock AnnProgulske-Fox

*Ann Progulske-Fox Department of Oral Biology Center for Molecular Microbiology College of Dentistry University of FloridaGainesvilleFL32610-0424USA+1 352 273 8835

Department of Oral Biology, Center for Molecular Microbiology College of Dentistry, University of Florida

GainesvilleFLUSA

Immunology Branch, US Army Dental and Trauma Research Detachment, Walter Reed Army Institute of Research Great Lakes Naval Training Center

Great LakesILUSA

Journal of Oral Microbiology ORIGINAL ARTICLE Peptidase M48 of Porphyromonas gingivalis and virulence Background: In vivo-induced antigen technology was previously used to identify 115 genes induced in Porphyromonas gingivalis W83 during human infection. One of these, PG2197, a conserved hypothetical protein which has homology to a Zn-dependent protease, was examined with respect to a role in disease. Design: The expression of PG2197 in human periodontitis patients was investigated, but as there is increasing evidence of a direct relationship between P. gingivalis and cardiovascular disease, a mutation was constructed in this gene to also determine its role in adherence, invasion, and persistence within human coronary artery endothelial cells (HCAEC) and neutrophil killing susceptibility. Results: Plaque samples from 20 periodontitis patients were analyzed by real-time PCR, revealing that PG2197 was expressed in 60.0% of diseased sites compared to 15.8% of healthy sites, even though P. gingivalis was detected in equal numbers from both sites. The expression of this gene was also found to be up-regulated in microarrays at 5 and 30 min of invasion of HCAEC. Interestingly, a PG2197 mutant displayed increased adherence, invasion, and persistence within HCAEC when compared to the wild-type strain. Conclusion: This gene appears to be important for the virulence of P. gingivalis, both in vivo and in vitro. Porphyromonas gingivalis IVIAT periodontitis cardiovascular disease An estimated 80% of American adults currently have some form of periodontal disease. In 2000, the cost of therapy in the USA for the treatment of periodontal disease was estimated at $5–6 billion 1. Periodontitis is an inflammation of the periodontium that results in destruction of the bone and connective tissue attachment of the teeth. Periodontal diseases can range in severity from the mildest form, gingivitis, to the more common, chronic periodontitis, to the most severe, necrotizing periodontal disease 2. The major characteristics of the disease are microbial plaque formation, periodontal inflammation, loss of attachment and alveolar bone, and consequent periodontal pocket formation 3. Porphyromonas gingivalis is recognized as an important bacterial species in the pathogenesis of periodontitis and is most often isolated from subgingival sites 4567. Many elements of periodontitis can be attributed to virulence factors from P. gingivalis, such as proteolysis, edema, neutrophil accumulation, and bleeding on probing 8. This bacterial species is also capable of invading several epithelial and endothelial cell lines including human coronary artery endothelial cells (HCAEC) 910. Cellular invasion is a mechanism by which bacteria can evade host immunologic defenses. Previous studies on the invasion of HCAEC by P. gingivalis were performed in relation to an epidemiological and experimental link observed between cardiovascular disease and the presence of periodontal pathogens such as P. gingivalis 910111213. Gene expression during invasion of HCAEC was also determined and microarray analyses demonstrated that 62 genes were differentially regulated 14.Virulence gene expression is modulated by bacteria in response to their environment 15. Previously, in vivo-induced antigen technology (IVIAT) 16 identified 115 P. gingivalis genes that were induced in vivo in humans during periodontal disease 17. One of the genes identified, PG2197 (conserved hypothetical protein, J. Craig Venter Institute; http://cmr.jcvi.org/tigr-scripts/CMR/shared/GenePage.cgi?locus=PG_2197), has domain homology to a Zn-dependent protease with chaperone function and may be an HtpX homologue. HtpX is a stress-controlled protease identified in Escherichia coli 18 that is under control of the two-component stress response system Cpx 1920. In this study, RT-PCR and real-time PCR were used to probe patient plaque samples to confirm in vivo gene expression of PG2197. In addition, microarrays were used to examine differential expression of PG2197 during co-cultivation with HCAEC. Additionally, a mutation was constructed in PG2197 and the mutant, as well as the parent strain were tested for 1 the ability to adhere, invade, and persist within HCAEC and 2 the ability to survive phagocytosis by mouse neutrophils. P. gingivalis W83 and W83▵2197 were grown as described elsewhere 21. HCAEC (Lonza, Walkersville, MD) were maintained at 37°C with 5% CO₂ in endothelial cell basal medium-2 (EBM-2) supplemented with EGM-2-MV singlequots (Lonza) according to the manufacturer's protocol. HCAEC were seeded at 1×10⁵ cells/well into 24-well tissue culture plates and incubated overnight in antibiotic-free EBM-2. P. gingivalis W83 cultures were grown in supplemented brain heart infusion (BHI) broth and subcultured. RNA was extracted as described below. Using criteria described elsewhere 22 and after Institutional Review Board approval, subgingival plaque samples were collected from two healthy and two diseased sites from 20 patients using a Gracey curette. Plaque was removed from the curette by sterile paper point and placed into 1 mL of Trizol (Invitrogen). Samples were vortexed and stored at –80°C for subsequent RNA extraction. RNA isolations were performed by using Trizol and the RNeasy kit (Qiagen) with DNase treatment as described elsewhere 12. Reverse transcription (RT) was performed by using Superscript III reverse transcriptase (Invitrogen) and random hexamer primers (Qiagen) following the manufacturer's protocol, reactions were incubated at 48°C for 16 hours. cDNA samples were purified by using the PCR purification kit (Qiagen) following the manufacturer's protocol. Primers (Table 1) were designed by using Beacon Designer software (Premier Biosoft International). P. gingivalis-specific 16S rRNA primers used were those previously reported 22. All other primers used were blasted against nucleotide databases to ensure specificity. Real-time RT-PCR was performed by using an iCycler Thermal Cycler and iQ SYBR green supermix according to the manufacturer's instructions (Bio-Rad Laboratories, Hercules, CA). DNA fragments of each gene were used as internal controls and in the generation of standard curves. All real-time PCR reactions were run with an annealing temperature of 55°C. Data normalization and analysis were performed by using iCycler and Microsoft Excel software. Gene expression was normalized to the P. gingivalis 16S rRNA expression. Application/Gene Primer name Sequence (5′→ 3′) Product size (bp) ^aProduct sizes are listed for both the wild-type and the mutant strains. Real-time RT-PCR  P. gingivalis 16S rRNA Pg 16s F Catagatatcacgaggaactccgatt 436 Pg 16s R Aaactgttagcaactaccgatgtgg  PG2197 PG2197 realtime F ACATCCACGGCACAGGTG 81 PG2197 realtime R TCCCAATCCGTTTTGCTTCAG Mutant construction  PG2197 2197 5' F GGTATGCCATGGAGGAAT 423 2197 5' R AAAAGGTACCGCAAGGCACTGGAGGACA 2197 3' F TTTTTCTAGAATCGGATAGCTGCCATTC 449 2197 3' R AGCTTCTACCTCTGCCTCTATT Mutant confirmation  W83▵2197 2197 confirm F GATTTCGGGGCGCAGTCAGA 2,236/3,837^a 2197 confirm R AGCGGATCGGAAAATTGGAGTCG W83▵2197 was constructed by allelic replacement as described elsewhere 21. Briefly, upstream and downstream regions of PG2197 were amplified by PCR using gene-specific primers (Table 1) and cloned into the suicide vector pPR-UF1. This vector has been described previously 11. The mutation was confirmed by PCR and growth curves were performed to confirm that growth rate was not altered (data not shown). The mutation was not expected to cause any polar effects since PG2197 does not appear to exist in an operon. Adhesion assays were performed as described elsewhere 23 with minor modifications. P. gingivalis W83 or W83▵2197 from overnight cultures were added to antibiotic-free EBM-2 and bacteria were allowed to adhere to HCAEC at a multiplicity of infection (MOI) of 100 for 30 min at 4°C. Non-adherent bacteria were washed away with cell-culture medium. Cells and adherent bacteria were fixed with 5% formalin for 15 min at 37°C, washed, and then blocked (5% BSA, 1% goat serum, and 0.1% Tween20 in PBS) for 1 hour at room temperature. Adherent bacteria were detected with polyclonal rabbit anti-P. gingivalis serum followed by a horseradish peroxidase (HRP)-labeled mouse anti-rabbit antibody (Cappel, Solon, OH). An ELISA was performed to confirm that the polyclonal antibody bound similarly to both W83 and W83▵2197. Colorimetric substrate 3,3′,5,5′-tetramethylbenzidine (Sigma, St. Louis, MO) was added to each well and incubated with the cells for 5 min at room temperature. The reaction was stopped with the addition of an equal volume of 1 N HCl and the OD₄₅₀ was measured with an ELISA plate reader (Bio-Rad). Wells containing cells alone or cells and bacteria with no primary antibody were used as controls. Invasion and persistence assays were performed as described previously 11. A total of 10⁵ HCAEC/well were seeded into a 24-well tissue culture plate and incubated at 37°C overnight. P. gingivalis W83 or W83▵2197 was added at a concentration of 10⁷ bacterial cells/ml per well (MOI of 100) and bacteria were allowed to invade the cells for 1.5 hours. After washing, 300 µg/mL gentamycin and 200 µg/mL metronidazole were added to kill extracellular bacteria. After an additional 1-hour incubation, the cells were washed and either lysed with 1 mL of water for 20 min and plated for enumeration on blood agar plates or antibiotic-free medium was added to the cells before reincubating. In the later case, at 6, 12, and 24 hours post-inoculation, the supernatant was collected and centrifuged at 600×g for 5 min. The pelleted bacteria were resuspended in PBS and plated on blood agar to enumerate the extracellular bacteria. Subsequently, HCAEC were lysed with water and intracellular bacteria were enumerated by plating on blood agar. All individual cell culture experiments were performed by using triplicate wells and each experiment was performed three times. P. gingivalis W83 microarray glass slides (version 2) were obtained from J. Craig Venter Institute (http://www.jcvi.org/). HCAEC were infected as described above with P. gingivalis W83. After 5 and 30 min, total RNA was isolated from internalized bacteria, RT and microarray reactions were performed as described elsewhere 14. Control reactions by using broth cultures and data analysis were done as described previously 14. The susceptibility of P. gingivalis to neutrophil killing was measured as described previously with minor modifications 24. Briefly, overnight cultures of E. coli S17-1 (control) and P. gingivalis W83 and W83▵2197 were pelleted and resuspended to 1×10⁸ CFU/mL in PBS. Each bacterial suspension (70 µL) was opsonized with 50 µL of polyclonal rabbit anti-P. gingivalis serum. After opsonization, 0.5 mL of the neutrophil suspension (5×10⁵ polymorphonuclear leukocytes) was added to the bacteria/serum mixture and incubated at 37°C at 300 rpm in a thermomixer. After 4 hours, a 30 µL sample was collected, diluted, and plated. Experiments were performed in triplicate. Comparisons between groups were done by using a Student t-test. Data that were not normally distributed were compared by using the Mann–Whitney Rank sum test. Differences in proportions were compared by using the Fisher's exact test plus Yate's correction. A value of P<0.05 was considered statistically significant. Real-time PCR was used to assay in vivo expression of gene PG2197 in plaque samples from human periodontitis patients. No statistically significant differences were observed in P. gingivalis detection (P>0.05) between the plaque sites; 73.5% of samples taken from the diseased sites were positive for P. gingivalis as measured by previously reported P. gingivalis-specific 16S primers 22 while 54.3% of healthy plaque samples tested positive for P. gingivalis. However, when comparing the expression pattern in diseased versus healthy plaque sites, PG2197 was expressed significantly more in diseased sites (60.0%) than in healthy sites (15.8%, P<0.01). Analysis of microarrays showed that a total of 160 P. gingivalis genes were differentially regulated at 5 min and a total of 67 genes were differentially regulated at 30 min of co-culture with HCAEC (Fig. 1). Of these, 18 genes were differentially regulated at both time points. At 5 min of contact, 56 and 104 genes were up and down-regulated, respectively (data not shown). At 30 min, 13 and 54 genes were up and down-regulated, respectively (data not shown). Gene PG2197 was, among those, found to be up-regulated at both the time points, 3.0 and 4.5-fold at 5 and 30 min, respectively. These data were confirmed by Real-Time PCR by using P. gingivalis-specific primers showing a 4.3 and 5.4-fold up-regulation when compared to the control.

Distribution of differentially expressed genes grouped by functional classification according to the TIGR P. gingivalis genome database. Numbers above the bars indicate the number of genes differentially expressed in each functional group after (A) 5 min or (B) 30 min adherence to HCAEC.

Mutant W83▵2197 demonstrated significantly enhanced adherence to HCAEC at 30 min when compared to W83 (2.6-fold, P<0.001, Fig. 2A) and the ability to invade HCAEC was also increased by 2.3-fold for W83▵2197 at 2.5 hours (P<0.01, Fig. 2B). However, when invasion efficiency was normalized to the adherence data, W83▵2197 showed no increase in invasion. The persistence of W83 and W83▵2197 within HCAEC was also examined. The results are expressed as the percentage of the wild-type that was recovered at 2.5 hours post-inoculation (Fig. 3). After 6 hours, more W83▵2197 were recovered from the medium (3.6-fold, P=0.06, Fig. 3A) than W83, although not statistically significant. After 12 hours, a similar percentage of W83▵2197 was recovered from within the cells when compared to W83 (Fig. 3B). However, at 6 and 24 hours greater numbers of W83▵2197 (1.6-fold, P<0.05; 3.1-fold, P<0.05) were recovered when compared to W83 (Fig. 3B).

Infection of HCAEC by P. gingivalis wild-type (black bar) and mutant strain (white bar). (A) Adherence to HCAEC at 4°C. The P. gingivalis strains were allowed to adhere to HCAEC for 30 min at 4°C (to prevent internalization of bacteria) before non-adherent bacteria were washed away. Host cells were then fixed with 5% formalin and probed with polyclonal rabbit anti-P. gingivalis serum followed by an HRP-labeled mouse anti-rabbit secondary antibody. The mutant strain W83▵2197 showed enhanced adherence to HCAEC (2.6-fold, P<0.001). (B) Invasion of HCAEC (2.5 hours) expressed as the percentage of inoculum. P. gingivalis W83 or W83▵2197 were allowed to invade HCAEC for 1.5 hours. Cells were washed and antibiotics were added to kill extracellular bacteria. After a 1-hour incubation, the cells were washed and lysed. The intracellular bacteria were diluted in PBS and plated for enumeration on blood agar. The PG2197 mutant demonstrated increased invasive ability at 2.5 hours compared to the wild-type (2.3-fold, P<0.01).

P. gingivalis W83 (black bar) and mutant W83▵2197 (white bar) detected extracellularly (A) or intracellularly (B) at 6, 12, and 24 hours after inoculation of HCAEC, expressed as the percentage of that strain recovered at 2.5 hours post-inoculation. P. gingivalis W83 or W83▵2197 were initially allowed to invade the HCAEC for 1.5 hours. The cells were then washed and antibiotics were added to kill extracellular bacteria. After an additional hour, the cells were again washed and antibiotic-free medium was added to the wells. At 6, 12, and 24 hours post-inoculation, the supernatants were collected, centrifuged the pelleted bacteria were resuspended in PBS and plated on blood agar to enumerate the extracellular bacteria (A). When compared to W83, more W83▵2197 were recovered from the medium at 6 hours (3.6-fold, P=0.06) although the difference was not statistically significant. In addition for (B), the infected HCAEC were washed and lysed with water to enumerate intracellular bacteria in a similar manner. More W83▵2197 (1.6-fold, P<0.05; 3.1-fold, P<0.05) were recovered at 6 and 24 hours when compared to the wild-type strain, W83. ND: No difference.

There was no statistical difference in the susceptibility to killing by neutrophils when P. gingivalis W83▵2197 was compared to W83 (Fig. 4).

Killing of P. gingivalis after four hours of incubation with mouse neutrophils. Overnight cultures of P. gingivalis W83, W83▵2197 and E. coli S17-1 were pelleted and resuspended to 1×10⁸ CFU/mL in PBS. Seventy five microliters of each bacterial suspension was opsonized with 50 µL of polyclonal rabbit anti-P. gingivalis serum. After opsonization, 0.5 mL of the neutrophil suspension (5×10⁵ PMN) was added to the bacteria/serum mixture. The mixtures were incubated at 37°C at 300 rpm in a thermomixer, and a 30 µL sample was diluted and plated after 4 hours. There was no statistical difference in the susceptibility to killing by neutrophils of P. gingivalis W83▵2197 when compared to the wild-type. This experiment was performed in triplicate.

Previously, IVIAT was used to identify immunogenic bacterial genes of P. gingivalis expressed specifically during infection but not in regular culture conditions 11. One of the genes identified by this technique, PG2197, is described as a conserved hypothetical protein and likely localizes to the inner or outer membrane (PSORT). PG2197 domain homology is recognized as a Zn-dependent protease with chaperone function. This class of metalloproteases belongs to the MEROPS peptidase family M48 and often is described as probable HtpX homologues 25. As IVIAT has previously identified in vivo-expressed genes that are likely related to virulence, characterization of this newly discovered gene in P. gingivalis was pursued to determine its relation to disease.This study reports that the PG2197 gene is significantly expressed in periodontitis disease sites (60%), but it is not frequently expressed in healthy sites (16%) even though P. gingivalis was detected in equal amounts from both sites. Thus, PG2197 shows a correlation to disease. Previously, we have reported that another IVIAT identified gene of P. gingivalis W83 (PG1334; a band 7/MEC-2 family gene) also had a higher expression in diseased sites versus healthy sites and again P. gingivalis was present in similar amount in both sites 11. Detection of P. gingivalis in similar frequency from periodontally healthy and diseased sites is not uncommon and has been previously observed 2627. Therefore, bacteria could be present but not necessarily expressing virulence genes until a triggering event happens and initiation of disease occurs.Since invasion of HCAEC has been used a model of host/pathogen interactions in relation to cardiovascular disease 910111213, microarray analysis was used to identify those genes of P. gingivalis W83 that are up-regulated in response to co-culture with HCAEC. This analysis detected differential expression of 160 and 67 genes during infection of HCAEC at 5 and 30 min, respectively. Most pertinent to this study, PG2197, was one of the genes identified as being up-regulated after only 5 and 30 min of contact with host cells, suggesting its importance in early colonization events. To further characterize the phenotypic trait of this gene, a mutation in the gene was constructed using allelic replacement. The mutant was tested for its ability to resist killing by mouse neutrophils and loss of this protein does not impact its susceptibility to killing by neutrophils. Quantitative invasion assays of the mutant and wild-type were then performed by using HCAEC, a cell model previously used to study virulence factors. Surprisingly, the adherence of W83▵2197 was increased when compared to adherence of the wild-type strain. As adherence is an initial event in invasion, it is possible that the enhanced invasion and persistence seen with the PG2197 mutant were only due to its increased adherence. This was confirmed when the invasion data were normalized to the adherence data. Cellular invasion is an important survival mechanism by which bacteria can evade host immunologic defenses. P. gingivalis has been previously shown to use this mechanism for survival 1028. Furthermore, extracellular bacteria were also recovered in the medium at all time points for both the wild-type and the mutant strains. This could be due to cell lysis and subsequent release of bacteria or by a mechanism used by P. gingivalis to ensure transmission from one cell to another. For example, a recent study demonstrated that P. gingivalis can exit infected cells and reinfect new host cells 29. Therefore, intracellular transmission without host cell lysis could be used as an important survival mechanism by this periodontal pathogen.The mechanism by which a mutation in the PG2197 gene affects adhesion to cells is at this point unknown. Based on homology, PG2197 or HtpX is a membrane-bound, stress-controlled protease identified in E. coli whose proteolytic active site is on the cytosolic side of the inner membrane 1920. This protease is under the control of the Cpx stress response, a two-component phosphorelay system capable of both autoamplification and feedback inhibition mechanisms 1920. The Cpx stress response may also become activated by the loss of HtpX function 20. In addition, it has been suggested that this system is important in the regulation of virulence factors. For example, Cpx regulates VirF in Shigella, which in turn activates the transcription of genes necessary for host-cell invasion 30. Furthermore, Cpx-regulated DsbA and DegP are essential for pili assembly on the surface of uropathogeneic E. coli 3132. Homologues for the two components of the Cpx system appear to exist in P. gingivalis: PG1797 (CpxA) and PG1089 (CpxR). If PG2197 is related to HtpX, then it is conceivable that this gene is regulated by a similar two component-response system. It is plausible that, similar to the loss of HtpX activating the Cpx system, the loss of PG2197 could activate its homologous response system and lead to up regulation of other virulence factors. This may explain the enhanced adhesion, invasion and persistence seen with the PG2197 mutant. Future experiments are needed to clarify the role of this gene including characterization of the proteolytic activity of PG2197 and determination if this gene is a component of the Cpx system.In conclusion, PG2197 appears to be important for the virulence of P. gingivalis, both in vivo and in vitro. There is no conflict of interest in the present study for any of the authors. We would like to thank Ikramuddin Aukhil and Luciana Shaddox for the collection of patient-plaque samples. This work was supported by the University of Florida Center for Molecular Microbiology and the National Institute of Dental and Craniofacial Research, National Institutes of Health Grant DE 13957. National Institute of Dental and Craniofacial Research. Periodontal (gum) disease: causes, symptoms and treatments; 2008. Available from: http://www.nidcr.nih.gov/OralHealth/Topics/GumDiseases/ [cited 19 November 2008]. RanneyRR. Classification of periodontal diseases Periodontol 2000 19932 1325 NewmanC. Carranza's clinical periodontologyninth ed W.B. Saunders CoPhiladelphiaPA2002 GriffenALBeckerMRLyonsSRMoeschbergerMLLeysEJ. Prevalence of Porphyromonas gingivalis and periodontal health status J Clin Microbiol 199836 323942 HaffajeeADSocranskySS. Microbial etiological agents of destructive periodontal diseases Periodontol 2000 19945 78111 LoescheWJSyedSASchmidtEMorrisonEC. Bacterial profiles of subgingival plaques in periodontitis J Periodontol 198556 44756 SlotsJBragdLWikstromMDahlenG. The occurrence of Actinobacillus actinomycetemcomitans, Bacteroides gingivalis and Bacteroides intermedius in destructive periodontal disease in adults J Clin Periodontol 198613 5707 OzmericNPreusNROlsenI. Genetic diversity of Porphyromonas gingivalis and its possible importance to pathogenicity Acta Odontol Scand 200058 1837 DornBRBurksJNSeifertKNProgulske-FoxA. Invasion of endothelial and epithelial cells by strains of Porphyromonas gingivalis FEMS Microbiol Let 2000187 13944 DornBRDunnJr. WAProgulske-FoxA. Invasion of human coronary artery cells by periodontal pathogens Infect Immun 199967 57928 WaltersSRodriguesPBélangerMWhitlockJProgulske-FoxA. Analysis of a band 7/MEC-2 family gene of Porphyromonas gingivalis J Dent Res 200988 348 YuanLRodriguesPHBélangerMDunnJr. WProgulske-FoxA. The Porphyromonas gingivalis clpB gene is involved in cellular invasion in vitro and virulence in vivo FEMS Immunol Med Microbiol 200751 38898 YuanLRodriguesPHBélangerMDunnJr. WAProgulske-FoxA. Porphyromonas gingivalis htrA is involved in cellular invasion and in vivo survival Microbiology 2008154 11619 RodriguesPHProgulske-FoxA. Gene expression profile analysis of Porphyromonas gingivalis during invasion of human coronary artery endothelial cells Infect Immun 200573 616973 MekalanosJJ. Environmental signals controlling expression of virulence determinants in bacteria J Bacteriol 1992174 17 HandfieldMBradyLJProgulske-FoxAHillmanJD. IVIAT: a novel method to identify microbial genes expressed specifically during human infections Trends Microbiol 20008 3369 SongYHKozarovEVWaltersSMCaoSLHandfieldMHillmanJD Genes of periodontopathogens expressed during human disease Ann Periodontol 20027 3842 SakohMItoKAkiyamaY. Proteolytic activity of HtpX, a membrane-bound and stress-controlled protease from Escherichia coli J Biol Chem 2005280 3330510 RaivioTLPopkinDLSilhavyTJ. The Cpx envelope stress response is controlled by amplification and feedback inhibition J Bacteriol 1999181 526372 ShimohataNChibaSSaikawaNItoKAkiyamaY. The Cpx stress response system of Escherichia coli senses plasma membrane proteins and controls HtpX, a membrane protease with a cytosolic active site Genes Cells 20027 65362 BélangerMRodriguesPProgulske-FoxA. Genetic manipulation of Porphyromonas gingivalis Curr Prot Microbiol 20071 13C.2.1C.2.24 ShelburneCEGleasonRMGermaineGRWolffLFMullallyBHCoulterWA Quantitative reverse transcription polymerase chain reaction analysis of Porphyromonas gingivalis gene expression in vivo J Microbiol Methods 200249 14756 TribbleGDMaoSJamesCELamontRJ. A Porphyromonas gingivalis haloacid dehalogenase family phosphatase interacts with human phosphoproteins and is important for invasion Proc Natl Acad Sci USA 2006103 1102732 CutlerCWKalmarJRArnoldRR. Phagocytosis of virulent Porphyromonas gingivalis by human polymorphonuclear leukocytes requires specific immunoglobulin G Infect Immun 199159 2097104 RawlingsNDBarrettAJ. Evolutionary families of metallopeptidases Methods Enzymol 1995248 183228 GornitskyMClarkDCSibooRAmselRIugovazIWooleyC Clinical documentation and occurrence of putative periodontopathic bacteria in human immunodeficiency virus-associated periodontal disease J Periodontol 199162 57685 WilsonMLopatinDOsborneGKieserJB. Prevalence of Treponema denticola and Porphyromonas gingivalis in plaque from periodontally-healthy and periodontally-diseased sites J Med Microbiol 199338 40610 DornBRDunnJr. WAProgulske-FoxA. Porphyromonas gingivalis traffics to autophagosomes in human coronary artery endothelial cells Infect Immun 200169 5698708 LiLMichelRCohenJDecarloAKozarovE. Intracellular survival and vascular cell-to-cell transmission of Porphyromonas gingivalis BMC Microbiol 20088 26 NakayamaSWatanabeH. Involvement of cpxA, a sensor of a two-component regulatory system, in the pH-dependent regulation of expression of Shigella sonnei virF gene J Bacteriol 1995177 50629 JonesCHDanesePNPinknerJSSilhavyTJHultgrenSJ. The chaperone-assisted membrane release and folding pathway is sensed by two signal transduction systems EMBO J 199716 6394406 Jacob-DubuissonFPinknerJXuZStrikerRPadmanhabanAHultgrenSJ. PapD chaperone function in pilus biogenesis depends on oxidant and chaperone-like activities of DsbA Proc Natl Acad Sci USA 199491 115526